9 μg L−1 for hexadecane (C16) and is equivalent to 0.03–0.009 p.p.m. The very low water solubility of these compounds BMN 673 molecular weight would have made their utilization

by the 12 field isolates difficult. However, although not at high levels, growth was observed through changes in the OD600 nm measurements. Some microbial organisms, such as some Pseudomonas, Acinetobacter, and Rhodococcus species, produce biosurfactants, which effectively make the hydrocarbons more available for microbial utilization (Beal & Betts, 2000; Chang et al., 2009; Henry & Abazinge, 2009). Pseudomonas and Rhodococcus species, in particular, are well known for their production of biosurfactants. In the current study, both achieved relatively high growth on all of the alkane substrates, and principally the mid-chain length alkanes. In summary, results suggest that members of the same community showed preference for specific carbon sources shown through their ability to utilize various diesel constituents, potentially leading to a cooperative hypothesis within the community. Some are likely to be competitive in a broader range of scenarios, while others may be more suited to specific conditions and habitats. The site isolates could be categorized into two classes of microorganisms,

which Crenolanib datasheet have previously been identified in terms of their survival strategy: the K-strategists and the r-strategists (Winogradsky, 1924; Kuznetsov et al., 1979; Andrews & Harris, 1985). The r-strategists exist mostly in a resting phase demonstrating brief periods of activity stimulated by the appearance ASK1 of an available substrate. Examples in the present study could be R. erythropolis, Pseudomonas sp. 1, and A. xylosoxidans 1. In contrast, the K-strategists are continually

and slowly active: for example Pseudomonas sp. 2 and 3, and Psychrobacter sp. 3. It was observed that, in general, organisms that were particularly good at degrading diesel were likely to fall into the r-strategists. Previous studies of communities utilizing a mixed hydrocarbon source have observed either antagonism and competition between the organisms or cometabolism (Bouchez et al., 1999; Mariano et al., 2008). The investigation demonstrated that high community diversity may allow for the coexistence of both K- and r-strategists and the compartmentalization of functions among key organisms resulting in the utilization of the whole spectrum of diesel fuel components. This work was supported by the Natural Environment Research Council and Napier University, Edinburgh. We would like to thank CORUS UK for the GC-MS analysis of the site diesel fuel and ERS Ltd (http://www.ersremediation.com/index.php) for access to the study site.

Four teeth in the CH-IPT group and one tooth in the 3Mix-MP group were radiographic failures. One tooth in each group showed pulp canal obliteration (PCO), which was not regarded as a radiographic failure. The types of radiographic failures found at the 6–11 month recall are shown in Table 3. Partial thickening of the periodontal space at the bifurcation was observed in two and four teeth of the CH-IPT and 3Mix-MP groups, respectively. One tooth in the CH-IPT group and two teeth in the 3Mix-MP group showed partial loss of the lamina dura. All of these were classified into Selleckchem AT9283 the observe group (Table 3). Treatment success at the 6–11 recall for the mandibular

first and second primary molars treated with CH-IPT and 3Mix-MP, respectively, from Fig. 1a are presented in Fig. 1b and that of the CH-IPT-treated mandibular first primary molar from Fig. 2a is seen in Fig. 2b. There was no statistically significant difference between overall success rates of the CH-IPT group or 3Mix-MP group at the 6–11 month recall (P = 0.91, Pearson chi-square). At the 12–29 month recall (mean = 22.81 ± 5.52 months), 72 of 82 teeth were available for a second evaluation. Six of 41 teeth in the CH-IPT group (15%) and 4 of 41 teeth (10%) in the 3Mix-MP group were dropped out. The distribution of teeth

seen at 12–29 months according to tooth Crizotinib research buy type and treatment group is shown in Table 1. Thirty-five of 35 teeth (100%) in the CH-IPT group and 35 of 37 teeth (95%) teeth in the 3Mix-MP group showed clinical success, whereas 33 of 35

teeth (94%) in the CH-IPT group and 30 of 37 teeth (81%) in the 3Mix-MP group showed radiographic success. PCO was found in seven teeth (20%) and eleven teeth (30%) in the CH-IPT and 3Mix-MP groups, respectively. The types of clinical and radiographic failures found at the 12–29 month recall are shown in Table 4. Of the teeth put into the ‘observed’ group, one of three IPT-treated teeth was deemed a failure, and all six 3Mix-MP-treated teeth were found to be successes. Examples of successful cases at 14-months for mandibular first and second primary molars treated with CH-IPT and 3Mix-MP, respectively, are seen in Fig. 1c. Although pulpal obliteration Phosphoglycerate kinase was observed in the CH-IPT-treated tooth, this was not a criterion for failure. A treatment failure at 25-months for a CH-IPT-treated mandibular first primary molar, due to internal resorption perforating the mesial root, is seen in Fig. 2c. Thirty-three of 35 teeth (94%) in the CH-IPT group and 29 of 37 teeth (78%) in the 3Mix-MP group showed overall treatment success. At the 12–29 month recall, there was no statistically significant difference between the overall success rates of CH-IPT or 3Mix-MP groups for the treatment of deep caries approaching the pulp in mandibular primary molars (P value = 0.08, Fisher,s Exact). (Table 2).

Hoechst 35,528 (Sigma, St Louis, MA, USA), a nuclear dye, was applied to reveal tissue architecture. Tissue autofluorescence in sections from adult GPCR Compound Library nmr mouse and primate brains was quenched with Sudan Black B (Schnell et al., 1999). Sections were inspected and representative images of immunoreactivity were acquired on a Zeiss 710LSM confocal laser-scanning microscope (Zeiss, Jena, Germany) equipped to separate emission signals through spectral detection and

unmixing. Emission spectra for each dye was limited as follows: Hoechst (420–485 nm), Cy2 (505–530 nm), Cy3 (560–610 nm) and Cy5 (640-720 nm). Image surveys were generated using the tile scan function with optical zoom varied from 0.6× to 1.5× at 10× primary magnification (objective: EC Plan-Neofluar 10×/0.30). Co-localization was defined as immunosignals being INCB024360 preset without physical signal separation in ≤ 1.0-μm optical slices at 40× (Plan-Neofluar 40×/1.30) or 63× (Plan-Apochromat 63×/1.40) primary magnification (Mulder et al., 2009b). Images were processed using the ZEN2009 software (Zeiss). Multi-panel

figures were assembled in CorelDraw X3 (Corel Corp., Ottawa, ON, Canada). The diameter of scgn+ neurons was measured after capturing images of scgn+ cell assemblies in pallidal and EA territories at 40× primary magnification. The somatic diameter of individual neurons was measured on the premise that scgn is a cytosolic protein (Attems Loperamide et al., 2007) and is homogenously distributed throughout the neuronal perikarya. Only neurons with smooth surfaces and processes were included in our analysis to avoid bias due to partial profiles of cell fragments. Serial coronal sections (sampling interval, 140 μm) spanning the entire forebrain from an E15 mouse were double-labelled to reveal scgn+ neurons and cell nuclei (Hoechst 35,528). Single x-y plane images were acquired (Zeiss 710LSM), and 3-D-reconstructed using the BioVis3D software (BioVis3D, Montevideo, Uruguay). Data are expressed as means ± SEM and analyzed using Student’s t-test (spss

v.16.0, SPSS Inc., Chicago, IL, USA). A P-value of < 0.05 was considered statistically significant. Human fetal specimens at mid-gestation (21–22 weeks of gestation; n = 3) were obtained from saline-induced abortions (Wang et al., 2004; Hurd et al., 2005). Protocols were approved by the local institutional review board (Institutional Review Boards of Kings County Hospital Center and Downstate Medical Center, State University of New York) as part of a large-scale study to evaluate the molecular effects of prenatal drug exposure on human neurodevelopment (Hurd et al., 2005). Specimens were fixed in 1% PFA and frozen at −80°C. Coronal cryosections (20 μm) spanning corticolimbic areas including the amygdaloid complex were cut. In situ hybridization was conducted as described (Wang et al.

, 1984). In this study, we identified three PDCs from the G. zeae genome and performed functional analyses of the genes. Although the PDC2 and PDC3 deletions had no observable defect, PDC1 deletion mutants exhibited defected perithecia maturation. These defects in perithecia Natural Product Library purchase maturation could be attributed to the reduced production of lipids in the aerial mycelia and reduced growth of embedded mycelia. These results, taken together with results from our previous study on ACSs, suggest that the PAA pathway plays a crucial role in the production of lipids in the aerial mycelia and growth of embedded mycelia in G. zeae. All strains used in this study are listed in Supporting information, Table S1. Minimal

medium containing 5 mM agmatine (MMA) was used to induce the production of trichothecenes (Gardiner et al., 2009). Conidia were induced using carboxymethyl cellulose (CMC) medium (Cappellini & Peterson, 1965). Standard laboratory methods and culture conditions for Fusarium

species were used (Leslie & Summerell, 2006). Fungal transformations were conducted as previously described (Han et al., 2007). Genomic HDAC inhibitor DNA extraction and Southern analysis using 32P-labeled probes were performed using standard protocols (Sambrook & Russell, 2001; Leslie & Summerell, 2006). PCR primers used in this study were synthesized by an oligonucleotide synthesis facility (Bionics, Seoul, Korea; Table S2). Constructs for gene deletion and complementation assays were generated using the double-joint (DJ) PCR method (Yu et al., 2004). Geneticin resistance cassettes (gen) were amplified with Gen-F/Gen-R primers and fused to the 5′ and 3′ flanking region of the genes targeted for deletion and amplified with the appropriate Cyclin-dependent kinase 3 primer pairs (Table S2). To generate the complementing construct for the PDC1 deletion mutant, the promoter and open reading frame (ORF) of the PDC1 gene were fused to GFP-hyg amplified using pIGPAPA-sGFP F/HYG-F1 primers from the pIGPAPA vector (Horwitz et al., 1999) and 3′ flanking region of PDC1 gene. To generate the strain containing both the PDC1 deletion and the ACS1-GFP fusion (HK60),

the ∆mat2 mutant was outcrossed with the ∆pdc1 strain, and progeny from this cross (∆mat2 ∆pdc1, strain HK59) were then cross-fertilized with the strain containing the ACS1-GFP fusion (HK23). The strain containing both the ACS1 deletion and the PDC1-GFP fusion (HK65) was generated by outcrossing (∆mat1; PDC1-GFP) × HK22 (∆acs1), and the ∆pdc1 ∆acs1 strain (HK61) was created by outcrossing HK59 × HK22. For every cross, progeny with the desired genetic characteristics were selected using antibiotic resistance, and genotypes were verified by PCR (Table S2). For self-fertilization, mycelia grown on carrot agar for 5 days were removed with a glass spreader or with the back of the surgical blade (surgical blade #11; Feather Safety Razor, Osaka, Japan) with 2.

This locus comprised a repA gene and an upstream 407-bp sequence containing two inverted repeats (IR-III and IR-IV)

within an iteron, an AT-rich region and a 300-bp noncoding sequence (NCS). RepA protein bound specifically to a 94-bp sequence covering the intact IR-III and IR-IV to form multimers of DNA/protein complexes, but was unable to bind specifically to the NCS and the promoter of repA gene. Interestingly, this ‘bound’ region also leaves eight 1-bp ‘unbound’ spacers at 7-11-9-11-9-11-9-11-8-bp intervals. RepA protein–protein interaction could form dimers or trimers in vitro. These results suggest that learn more a higher-order complex between pSV1 RepA protein and the long inverted repeats may be formed during the initiation of plasmid replication. “
“To understand the mechanism of soil microbial ecosystem

and biochemical properties in suppressing soilborne plant diseases, the relationship between the soil rhizosphere microbial communities, hydrolase activities, and different disease-resistant cultivars was investigated. There were statistically significant differences in microbial diversity in the rhizosphere soil between the disease-tolerant cultivar Fj01 and susceptible cultivar Baxi. The rhizosphere soil of Fj01 showed a trend of higher microbial diversity than that of Baxi. At the same growth stage, the similar trends of variation in microbial community diversity between the two different cultivars were Selleck Apitolisib observed. The bacterial community abundance in rhizosphere soil from the two banana cultivars was quantified by real-time PCR assays. The size of the rhizosphere bacterial population from the Fj01 was significantly larger than that from the Baxi during the growing stage from July to September. The activities of urease and phosphatase

were analyzed to study the effects of the two banana cultivars to soil ecosystem functioning. Urease activity was significantly higher in the rhizosphere soil of Fj01 than that of Baxi in the period from July to September. However, phosphatase activity showed no significant difference between the two different rhizosphere soils. “
“Lactococcus garvieae, the pathogenic species in the genus Lactococcus, is recognized as an emerging pathogen in fish, animals, and humans. Despite the widespread distribution and emerging clinical significance of L. garvieae, little is Etomidate known about the genomic content of this microorganism. Suppression subtractive hybridization was performed to identify the genomic differences between L. garvieae and Lactococcus lactis ssp. lactis, its closest phylogenetic neighbor, and the type species of the genus Lactococcus. Twenty-seven clones were specific to L. garvieae and were highly different from Lactococcus lactis in their nucleotide and protein sequences. Lactococcus garvieae primer sets were subsequently designed for two of these clones corresponding to a pyrH gene and a novel DNA signature for application in the specific detection of L. garvieae.

, 2001, 2003). FlhD by itself, independent of FlhC, has also been reported to regulate cell division in E. coli (Prüß

& Matsumura, 1996). Cells in flhD mutant cultures were observed to continue dividing for several generations after cells in the flhD+ parental culture had stopped growing and entered the stationary Sirolimus cell line phase. This work is frequently cited as evidence that FlhD regulates cell division (Kaper & Sperandio, 2005; Umehara et al., 2007; Cui et al., 2008; Hatt & Rather, 2008; Isalan et al., 2008); however, our data indicate that this is not the case. We re-examined the effects of flhD mutations on entry to the stationary phase and found that the previously observed phenotype is not due to the flhD locus. Here, we show that the difference in the final cell number is due to the thyA mutation in the parental flhD+ strain, which had apparently reverted in the flhD− mutant strain used in the study. When the strains being compared have the same thyA allele (wild type or mutant), flhD mutations have no effect on growth. The E. coli K-12 strains and phage used in this study are listed in Table 1. λWM7 (Mao & Siegele, 1998) is a derivative of λRS45 (Simons et al., 1987) that carries an operon fusion between the mcb operon promoter (positions

−344 to +79) and the lac operon. Strains lysogenic for λWM7 were isolated by infecting YK410 and YK4131 with λWM7 and screening survivors on medium containing X-Gal selleck products where lysogens form blue colonies. Monolysogens were identified by measuring β-galactosidase activity in several independent Adenosine isolates of

each lysogen. Transductions with P1vir were performed as described by Miller (1972). Hfr mapping was performed as described (Singer et al., 1989) using the Hfr strains described in that paper as donors. To facilitate the exchange of flhD alleles, derivatives of YK410 (λPmcb-lacZ) and YK4131 (λPmcb-lacZ) were constructed that carry the linked uvrC279∷Tn10 mutation and retain their original flhD allele. These are strains DS507 and DS511, respectively, which were used as the donor strains in all subsequent strain constructions. Motility assays (described below) were used to determine whether transductants carried the wild type or the mutant flhD allele. Introduction of the uvrC279∷Tn10 mutation did not affect the expression of the Pmcb-lacZ fusion (Table 2 and data not shown). For β-galactosidase assays, cultures were grown in TB medium [1% Bacto tryptone, 0.5% NaCl (Arber et al., 1983)] supplemented with MgSO4 (10 mM), thymidine (10 μg mL−1), and thiamine (2 μg mL−1). For plates, 1.3% Bacto agar (Difco Laboratories) was included.

Ina168m95-1 contains a conserved Occan element, named Occanm95-1, between sequences homologous to the 5′-flanking region of Occan3A3

and the 3′-flanking region of Occan9E12. In addition, sequence polymorphisms indicated a homologous recombination between Occan3A3 and Occan9E12, which resulted in Occanm95-1. Based on these observations, we propose the hypothesis that homologous recombination in the two Occan elements leads to the deletion of AVR-Pia in Ina168m95-1. SAHA HDAC research buy “
“The cuticle of plants that covers the epidermis of cells, an interface between the fruit and the environment, has an important role to play in fruit quality because it prevents water loss and mechanical damage while simultaneously forming a barrier as it prevents phytopathogens from entering the fruit. All these factors give rise to flaws in the appearance of the fruit, thus contributing to marketing problems in the form of financial loss. In the search for solutions to some of these problems, certain biocontrolling yeasts have been introduced

in the last few years. In the study described here, the changes observed on the surface of the whole tomato were evaluated in vivo during the first 72 h after inoculation by spraying Candida guilliermondii yeast onto the fruit’s surface. The measurements were taken on a nanometric scale using atomic force microscopy; images were created in both contact and tapping modes. The results showed diminished roughness selleck of the surface, which could contribute to reduced phytopathogen

adherence due to the thinner contact area. These results furthermore showed that a yeast biofilm was formed on the fruit which probably helps to improve water retention inside the fruit. “
“Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) using ribosomal subunit proteins coded in the S10–spc-alpha operon as biomarkers was applied for the classification of the Sphingomonadaceae from the environment. To construct a ribosomal protein database, S10-spc-alpha operon of type strains oxyclozanide of the Sphingomonadaceae and their related alkylphenol polyethoxylate (APEOn)-degrading bacteria were sequenced using specific primers designed based on nucleotide sequences of genome-sequenced strains. The observed MALDI mass spectra of intact cells were compared with the theoretical mass of the constructed ribosomal protein database. The nine selected biomarkers coded in the S10-spc-alpha operon, L18, L22, L24, L29, L30, S08, S14, S17, and S19, could successfully distinguish the Sphingopyxis terrae NBRC 15098T and APEOn-degrading bacteria strain BSN20, despite only one base difference in the 16S rRNA gene sequence.

In conclusion, the findings in the present study support the views of antivirulence as a new antibacterial approach for chemotherapy, and the pathogenicity of S. aureus in pneumonia could be decreased by inhibiting the production of α-toxin. We thank Professor

Timothy J. Foster (Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin, Ireland) for kindly providing S. aureus strains 8325-4 and DU 1090. This work was supported by the National Nature Science Foundation of China (No. 31072168) and Chongqing Engineering Technology Research Centre of Veterinary Drug. J.Q., M.L., and J.W. contributed equally to this work. “
“Genetic analysis of Bacteroides fragilis (BF) is hindered because of the lack of efficient transposon mutagenesis methods. Here, we describe GS-1101 purchase a simple method for transposon mutagenesis using Acalabrutinib datasheet EZ::TN5, a commercially available system that we optimized for use in BF638R. The modified EZ::TN5 transposon contains an Escherichia coli conditional origin of replication, a kanamycin resistance gene for E. coli, an erythromycin resistance gene for BF, and 19 basepair transposase recognition sequences on either ends.

Electroporation of the transposome (transposon–transposase complex) into BF638R yielded 3.2 ± 0.35 × 103 CFU μg−1 of transposon DNA. Modification of the transposon by the BF638R restriction/modification system increased transposition efficiency sixfold. Electroporation of the EZ::TN5 transposome results in a single-copy insertion Telomerase of the transposon evenly distributed across the genome of BF638R and can be used to construct a BF638R transposon library. The transposon was also effective in mutating a BF clinical isolate and a strain of the related species, Bacteroides thetaiotaomicron. The EZ::TN5-based mutagenesis described here is more efficient than other transposon mutagenesis approaches previously reported for BF. Bacteroides fragilis is a Gram-negative, anaerobic bacterium associated with the gastrointestinal (GI) tract of animals and humans (Gilmore & Ferretti, 2003) and is the major Bacteroides species isolated from human infections (80%) (Bennion et al., 1990; Wexler

et al., 1998; Wexler, 2007). As a commensal, it hydrolyzes complex polysaccharides and produces volatile fatty acids used by the host as source of energy (Wexler, 2007). When BF escapes the GI tract, it can cause serious infections (Gilmore & Ferretti, 2003). Investigation of the BF genetic makeup and its regulatory processes will aid in understanding how BF can evolve from a benign commensal to a multidrug-resistant pathogen. The function of most genes cannot be determined from primary sequence analysis alone (Cerdeno-Tarraga et al., 2005; Patrick et al., 2010), and the creation of mutants (Mazurkiewicz et al., 2006) is a useful tool for deducing gene function. As transposons are known for their random insertion into the genome, they have been widely used for the construction of mutant libraries (Jacobs et al.

To clone all three initiation factors under control of the BAD promoter, coding regions were amplified from the DH5α chromosome and cloned into the

NotI and XbaI sites of pKAN6. The 5′- primers contained the same ribosome-binding site and spacer to ensure the same level of protein expression. The primer sequence MDV3100 is as follows: 5′-GGCATGCGCGGCCGCAATAATTTTGTTTAACTTTAAGAAGAGATATACCATG plus 17 nucleotides of the gene-specific sequence (the start codon is underlined). The 3′- primers had the same sequence, except for the sequence corresponding to the coding region, namely 5′-GGATCCTCTAGATTA plus 17 nucleotides of the gene-specific sequence (the stop codon is underlined). MICs were determined as described previously (Lee et al., 1996). Western blot analysis of the CAT protein and Antiinfection Compound Library manufacturer IF1 was performed as described previously (Cummings & Hershey, 1994; Kim et al., 2009). Ribosome purification and primer extension analysis were performed as described previously (Lee et al., 1996; Kim et al., 2009). To investigate the functional role played by G791 during the process of protein synthesis, we adopted a novel genetic approach using the specialized ribosome system (Lee et al., 1997, 2001). In the specialized ribosome system used in this study, the chloramphenicol acetyltransferase (CAT) reporter message is translated exclusively by plasmid (pRNA122)-derived ribosomes (pRNA122 ribosomes),

which cannot translate normal cellular messages. Thus, it is possible to measure the function of the plasmid-derived mutant ribosomes in vivo by determining the amount of CAT protein synthesized in cells that express the mutant Ergoloid ribosomes. This specialized ribosome system offers a genetic method to select for mutants that restore CAT protein synthesis ability to mutant ribosomes, because the degree of resistance to chloramphenicol (Cm) of cells is proportional to the CAT activity or the amount of CAT protein produced in the cells by the mutant ribosomes (Lee et al., 1997, 2001; Song et al., 2007;

Kim et al., 2009). We suspected the involvement of the 790 loop in interaction with ligands involved in translation because of the accessibility of the loop to solvents and the structural features of bases at positions 789–791. Consequently, we considered the possibility that a base substitution at position 791 may cause a structural perturbation in the 790 loop that prevents the 30S ribosome from interacting with ligands. To examine this possibility, we used a genetic complementation approach to identify such ligands. A genomic library was constructed in pKAN3 using Escherichia coli genomic DNA from the DH5α strain partially digested with EcoRI. This plasmid contains a replication origin from pACYC177 (Chang & Cohen, 1978) and a deletion of bla. Constructs of this vector are compatible with the pRNA122 plasmid, which is a pBR322 derivative.

1% (768/1420) were for men, with 62.0% (476/768) of men going on to receive alcohol brief advice, compared with 57.5%

(375/652) women. Four per cent men (31/768) were referred to specialist services compared with 2.7% women (18/652). The percentage of men in the top three risk categories was substantially higher than women (see Table 1). For the age groups below 45, women were more likely to be screened than men, compared with the over 50 age bracket where men were more likely to be screened than women. A substantial number of alcohol IBA were delivered through community pharmacies to a wide cross-section of the population. The uptake of alcohol IBA by men was greater than that of women. NICE suggests targeting the delivery of screening and brief advice to selected populations at an appropriate time and in an appropriate setting.1 Given the good uptake of IBA and the this website benefit of IBA within the male population, community pharmacies may be an appropriate setting to focus on screening and provide IBA to men. Further work evaluating the effectiveness of community pharmacies in delivering alcohol-related services

are needed. 1) NICE. Services for the RAD001 purchase identification and treatment of hazardous drinking, harmful drinking and alcohol dependence in children, young people and adults. Commissioning Guide. 2011. 2) Kaner EF, Dickinson HO, Beyer FR, Campbell F, Schlesinger C, Heather N, Saunders JB, Burnand B, Piener ED. Effectiveness of brief alcohol interventions in primary care, populations (Review). The Cochrane Library 2009.

C. Morecroft, L. Stokes, A. Mackridge Liverpool John Moores University, Liverpool, UK The study shows that the emergency supply of prescription-only medicines at community pharmacies has potential to maximise patient adherence through continuation of supply without need to access other NHS services. Findings indicate wide support for a structured, national NHS-funded, emergency supply service from community pharmacies. The Medicines Act 1968, and latterly the Human Medicines Regulations 2012, permit community pharmacists to supply prescription-only medicines without a prescription, in an emergency when requested by either a prescriber or the patient.1 This enables pharmacists to use their professional judgement to ensure patients’ medicine(s) C-X-C chemokine receptor type 7 (CXCR-7) supply is not disrupted. Under this provision, pharmacists must ensure there is an ‘immediate need’ for the requested medicine, while also considering the wellbeing of the patient and the consequences of not supplying.2 The aim of this research was to explore the delivery of an emergency supply service of prescription-only medicines in community pharmacies in response to patient requests, including identifying how it may be integrated into established health and social care provision in order to fulfil its potential to maximise adherence.