To clone all three initiation factors under control of the BAD promoter, coding regions were amplified from the DH5α chromosome and cloned into the

NotI and XbaI sites of pKAN6. The 5′- primers contained the same ribosome-binding site and spacer to ensure the same level of protein expression. The primer sequence MDV3100 is as follows: 5′-GGCATGCGCGGCCGCAATAATTTTGTTTAACTTTAAGAAGAGATATACCATG plus 17 nucleotides of the gene-specific sequence (the start codon is underlined). The 3′- primers had the same sequence, except for the sequence corresponding to the coding region, namely 5′-GGATCCTCTAGATTA plus 17 nucleotides of the gene-specific sequence (the stop codon is underlined). MICs were determined as described previously (Lee et al., 1996). Western blot analysis of the CAT protein and Antiinfection Compound Library manufacturer IF1 was performed as described previously (Cummings & Hershey, 1994; Kim et al., 2009). Ribosome purification and primer extension analysis were performed as described previously (Lee et al., 1996; Kim et al., 2009). To investigate the functional role played by G791 during the process of protein synthesis, we adopted a novel genetic approach using the specialized ribosome system (Lee et al., 1997, 2001). In the specialized ribosome system used in this study, the chloramphenicol acetyltransferase (CAT) reporter message is translated exclusively by plasmid (pRNA122)-derived ribosomes (pRNA122 ribosomes),

which cannot translate normal cellular messages. Thus, it is possible to measure the function of the plasmid-derived mutant ribosomes in vivo by determining the amount of CAT protein synthesized in cells that express the mutant Ergoloid ribosomes. This specialized ribosome system offers a genetic method to select for mutants that restore CAT protein synthesis ability to mutant ribosomes, because the degree of resistance to chloramphenicol (Cm) of cells is proportional to the CAT activity or the amount of CAT protein produced in the cells by the mutant ribosomes (Lee et al., 1997, 2001; Song et al., 2007;

Kim et al., 2009). We suspected the involvement of the 790 loop in interaction with ligands involved in translation because of the accessibility of the loop to solvents and the structural features of bases at positions 789–791. Consequently, we considered the possibility that a base substitution at position 791 may cause a structural perturbation in the 790 loop that prevents the 30S ribosome from interacting with ligands. To examine this possibility, we used a genetic complementation approach to identify such ligands. A genomic library was constructed in pKAN3 using Escherichia coli genomic DNA from the DH5α strain partially digested with EcoRI. This plasmid contains a replication origin from pACYC177 (Chang & Cohen, 1978) and a deletion of bla. Constructs of this vector are compatible with the pRNA122 plasmid, which is a pBR322 derivative.